Detection of DNA Sequences on Chromosomes of the Eastern Oyster

	Texas Chapter of the American Fisheries Society

From the 2000 Joint Meeting of the Arkansas, Louisiana, and Texas Chapters of the American Fisheries Society held in Bossier City, Louisiana.

Detection of DNA Sequences on Chromosomes of the Eastern Oyster

Zhang, Q., G. Yu, R. K. Cooper, and T. R. Tiersch, Aquaculture Research Station, Louisiana Agricultural Experiment Station, Louisiana State University Agricultural Center, Baton Rouge, LA 70820

Genome mapping of the eastern oyster Crassostrea virginica is long-term solution for genetic improvement of this commercially important species. Our laboratory has established techniques for in-situ mapping of DNA sequences in aquatic species, including identification of individual chromosomes, standardization of karyotypes, and fluorescence in-situ hybridization. The objective of this study was to apply these techniques for analysis of chromosomal location of DNA sequences derived from the eastern oyster. Chromosomes were obtained from larvae 4 hr after fertilization and were prepared on two-well slides. Ten DNA sequences were selected to use in this study (Table 1). Probe DNA was amplified and labeled by polymerase chain reaction (PCR) with inclusion of biotin-labeled


Sequences	Source of sequence	Forward primer (5’-3’)	Reverse primer (5’- 3’)	Label	Location

Actin	Human	ttgtaaccaactgggacgatatgg	gatcttgatcttcatggtgctagg	biotin	Chromosome 7
BIK310	Oyster	cacacccacacacctatgc	atcctcctccttgattctctc	biotin	Chromosome 5
BIK750	Oyster	same	same	biotin	To be determined
cv-19	Oyster	ctttattttttaccattgcc	taagttgtttctgatccttttg	biotin	To be determined
cv-32	Oyster	ttcagaacaatgcaactctctttggg	ataacagggtcacaacaatcatctgg	biotin	To be determined
cv-7.4	Oyster	aattgtttctcattggattgct	atcatygccagttccataaatg	biotin	To be determined
Metallothionein	Oyster	taaagatgtctgacccatgtaactg	atcatcactcggtacaggagaac	biotin	Chromosome 1
c-myc	Oyster	tgtgatacatacggatgg	gaagttgggaataagttgg	biotin	To be determined
18S rDNA	Oyster	cgcgcaaattacccactcc	tccaagcctttcacctctaacc	digoxigenin	Chromosome 2
Telomere repeat	human	ggttttctgtcattcttgttga	agtgagtggagattgcattg	digoxigenin	All chromosomes

primers, or biotin- or digoxigenin-labeled nucleotides in the reactions. Primers were synthesized based on published sequences, and PCR products were verified by analysis of nucleotide sequence. Chromosomal images were recorded by fluorescence microscopy and gene location was identified with assistance of the Optimas^TM (version 5.1a) computer software package. Among the DNA probes tested, the human telomere repeat was mapped to telomeric regions of all chromosomes and the actin probe mapped to chromosome 7 (Figure 1). The location of several sequences remain to be analyzed (Table 1). Results of this study will help establish DNA markers for each chromosome, which is an essential step for large-scale physical mapping in the eastern oyster, and for verifying and complementing genetic linkage maps.

Note: View Figure1 by downloading the
Adobe Acrobat version of the ArkLaTex 2000 abstracts

Back to Abstract
Index

Back to ArkLaTex 2000
Home Page